eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| gaucher disease | ||||
| Disease ID | 3 |
|---|---|
| Disease | gaucher disease |
| Definition | An autosomal recessive disorder caused by a deficiency of acid beta-glucosidase (GLUCOSYLCERAMIDASE) leading to intralysosomal accumulation of glycosylceramide mainly in cells of the MONONUCLEAR PHAGOCYTE SYSTEM. The characteristic Gaucher cells, glycosphingolipid-filled HISTIOCYTES, displace normal cells in BONE MARROW and visceral organs causing skeletal deterioration, hepatosplenomegaly, and organ dysfunction. There are several subtypes based on the presence and severity of neurological involvement. |
| Synonym | acid beta glucosidase defic dis acid beta-glucosidase deficiency acid beta-glucosidase deficiency disease adult gaucher disease anemia, splenic, familial cerebroside lipidoses, glucosyl cerebroside lipidosis syndrome cerebroside lipidosis syndromes cerebroside lipidosis, glucosyl cerebroside lipoidosis cerebroside lipoidosis gauchers adult form chronic adult gaucher's disease chronic non-neuropathic gaucher disease chronic non-neuropathic gaucher's disease chronic non-neuropathic gaucher's disease (disorder) deficiencies, glucocerebrosidase deficiency disease, glucocerebrosidase deficiency diseases, glucocerebrosidase deficiency, glucocerebrosidase disease gaucher disease gaucher's disease gauchers disease, gaucher disease, gaucher's disease, gauchers disease, glucocerebrosidase deficiency diseases, gauchers diseases, glucocerebrosidase deficiency familial splenic anemia gaucher dis gaucher disease [disease/finding] gaucher splenomegaly gaucher syndrome gaucher's disease gaucher's disease (disorder) gaucher's disease [ambiguous] gaucher's disease, nos gauchers dis gauchers disease gauchers diseases gba glucocerebrosidase defic dis glucocerebrosidase deficiencies glucocerebrosidase deficiency glucocerebrosidase deficiency disease glucocerebrosidase deficiency diseases glucocerebrosidoses glucocerebrosidosis glucosyl cerebroside lipidoses glucosyl cerebroside lipidosis glucosylceramidase deficiency glucosylceramidase deficiency, chronic type glucosylceramide beta glucosidase defic dis glucosylceramide beta-glucosidase deficiency glucosylceramide beta-glucosidase deficiency (disorder) glucosylceramide beta-glucosidase deficiency disease glucosylceramide lipidoses glucosylceramide lipidosis histiocytoses, kerasin histiocytoses, lipoid (kerasin type) histiocytosis, kerasin histiocytosis, lipid, kerasin type histiocytosis, lipoid (kerasin type) kerasin histiocytoses kerasin histiocytosis kerasin lipoidoses kerasin lipoidosis kerasin thesaurismoses kerasin thesaurismosis kerasin thesaurismosis (disorder) lipidoses, glucosyl cerebroside lipidoses, glucosylceramide lipidosis syndrome, cerebroside lipidosis syndromes, cerebroside lipidosis, cerebroside lipidosis, glucosyl cerebroside lipidosis, glucosylceramide lipoid histiocytoses (kerasin type) lipoid histiocytosis (kerasin type) lipoidoses, kerasin lipoidosis, kerasin splenomegaly, gaucher syndrome, cerebroside lipidosis syndrome, gaucher syndromes, cerebroside lipidosis thesaurismoses, kerasin thesaurismosis, kerasin |
| Orphanet | |
| OMIM | |
| DOID | |
| ICD10 | |
| UMLS | C0017205 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:45) C0040034 | thrombocytopenia | 4 C0030567 | parkinson's disease | 4 C0030567 | parkinson disease | 4 C0005940 | bone disease | 3 C0017205 | glucocerebrosidase deficiency | 3 C0014544 | epilepsy | 3 C0020541 | portal hypertension | 2 C0020538 | hypertension | 2 C1136085 | monoclonal gammopathy | 2 C0023418 | leukemia | 2 C0002871 | anemia | 2 C0008370 | cholestasis | 2 C0024291 | hemophagocytic lymphohistiocytosis | 1 C0043117 | immune thrombocytopenic purpura | 1 C0751778 | progressive myoclonus epilepsy | 1 C0017205 | gaucher disease | 1 C0271270 | oculomotor apraxia | 1 C0034072 | cor pulmonale | 1 C0023895 | liver disease | 1 C0028064 | niemann-pick disease | 1 C0026764 | multiple myeloma | 1 C0023448 | lymphoblastic leukemia | 1 C0236642 | pick disease | 1 C0042373 | vascular disease | 1 C0023449 | acute lymphoblastic leukemia | 1 C0029443 | osteomyelitis | 1 C0393571 | multiple system atrophy | 1 C0020542 | pulmonary hypertension | 1 C0009451 | communicating hydrocephalus | 1 C0079731 | b cell lymphoma | 1 C0003635 | apraxia | 1 C0085078 | lysosomal storage disorders | 1 C0020455 | hyperimmunoglobulinemia | 1 C0019045 | hemoglobinopathy | 1 C0014867 | esophageal varices | 1 C0020255 | hydrocephalus | 1 C0751778 | progressive myoclonic epilepsy | 1 C0020757 | ichthyosis | 1 C0042345 | varices | 1 C0600452 | hepatopulmonary syndrome | 1 C0006123 | branch retinal artery occlusion | 1 C0024299 | lymphoma | 1 C0152025 | polyneuropathy | 1 C0008350 | cholelithiasis | 1 C0035302 | retinal artery occlusion | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:5) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:10) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:76) 427 | ASAH1 | 1.159 | DISEASES 23400 | ATP13A2 | 2.221 | DISEASES 8706 | B3GALNT1 | 1.631 | DISEASES 627 | BDNF | 1.036 | DISEASES 632 | BGLAP | 2.229 | DISEASES 23066 | CAND2 | 1.047 | DISEASES 388372 | CCL4L1 | 1.734 | DISEASES 9332 | CD163 | 1.873 | DISEASES 912 | CD1D | 1.804 | DISEASES 959 | CD40LG | 1.609 | DISEASES 55835 | CENPJ | 1.306 | DISEASES 1117 | CHI3L2 | 1.718 | DISEASES 27159 | CHIA | 3.322 | DISEASES 66005 | CHID1 | 2.236 | DISEASES 1118 | CHIT1 | 4.892 | DISEASES 2055 | CLN8 | 1.015 | DISEASES 51287 | COA4 | 2.334 | DISEASES 1431 | CS | 1.661 | DISEASES 10675 | CSPG5 | 1.214 | DISEASES 5476 | CTSA | 4.361 | DISEASES 1520 | CTSS | 2.089 | DISEASES 1565 | CYP2D6 | 1.21 | DISEASES 114327 | EFHC1 | 1.161 | DISEASES 2160 | F11 | 1.449 | DISEASES 10712 | FAM189B | 2.799 | DISEASES 2550 | GABBR1 | 1.106 | DISEASES 57704 | GBA2 | 5.44 | DISEASES 57733 | GBA3 | 4.765 | DISEASES 2632 | GBE1 | 1.001 | DISEASES 10457 | GPNMB | 2.303 | DISEASES 3043 | HBB | 1.659 | DISEASES 3320 | HSP90AA1 | 1.04 | DISEASES 3586 | IL10 | 1.312 | DISEASES 3609 | ILF3 | 2.728 | DISEASES 83737 | ITCH | 1.311 | DISEASES 3916 | LAMP1 | 2.427 | DISEASES 3920 | LAMP2 | 1.734 | DISEASES 197021 | LCTL | 1.915 | DISEASES 51557 | LGSN | 3.439 | DISEASES 3988 | LIPA | 2.082 | DISEASES 1130 | LYST | 1.106 | DISEASES 4121 | MAN1A1 | 1.736 | DISEASES 10227 | MFSD10 | 2.155 | DISEASES 25834 | MGAT4C | 3.475 | DISEASES 4566 | MT-TK | 1.482 | DISEASES 4580 | MTX1 | 2.391 | DISEASES 4599 | MX1 | 1.71 | DISEASES 4668 | NAGA | 1.077 | DISEASES 4698 | NDUFA5 | 1.441 | DISEASES 25915 | NDUFAF3 | 1.808 | DISEASES 25983 | NGDN | 3.249 | DISEASES 58484 | NLRC4 | 1.974 | DISEASES 256933 | NPB | 1.2 | DISEASES 10577 | NPC2 | 2.355 | DISEASES 256281 | NUDT14 | 2.869 | DISEASES 54681 | P4HTM | 1.177 | DISEASES 5071 | PARK2 | 2.119 | DISEASES 11315 | PARK7 | 1.289 | DISEASES 22984 | PDCD11 | 2.429 | DISEASES 65018 | PINK1 | 1.364 | DISEASES 5313 | PKLR | 3.771 | DISEASES 5660 | PSAP | 4.878 | DISEASES 100526737 | RBM14-RBM4 | 1.862 | DISEASES 57556 | SEMA6A | 1.348 | DISEASES 5271 | SERPINB8 | 1.251 | DISEASES 6512 | SLC1A7 | 1.509 | DISEASES 6609 | SMPD1 | 2.575 | DISEASES 27293 | SMPDL3B | 2.3 | DISEASES 6622 | SNCA | 3.5 | DISEASES 6668 | SP2 | 2.177 | DISEASES 81493 | SYNC | 1.88 | DISEASES 6916 | TBXAS1 | 1.81 | DISEASES 7059 | THBS3 | 3.516 | DISEASES 7124 | TNF | 1.633 | DISEASES 7357 | UGCG | 4.894 | DISEASES 7421 | VDR | 1.304 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 3 |
|---|---|
| Disease | gaucher disease |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:68) HP:0001103 | Abnormality of the macula HP:0012378 | Fatigue HP:0002015 | Dysphagia HP:0001654 | Abnormality of the heart valves HP:0002653 | Bone pain HP:0002119 | Ventriculomegaly HP:0000365 | Hearing impairment HP:0000657 | Oculomotor apraxia HP:0002027 | Abdominal pain HP:0001000 | Abnormality of skin pigmentation HP:0001697 | Abnormality of the pericardium HP:0002376 | Developmental regression HP:0001373 | Joint dislocation HP:0000093 | Proteinuria HP:0002797 | Osteolysis HP:0001789 | Hydrops fetalis HP:0003330 | Abnormal bone structure HP:0001637 | Abnormality of the myocardium HP:0002829 | Arthralgia HP:0001251 | Ataxia HP:0001873 | Thrombocytopenia HP:0000486 | Strabismus HP:0002206 | Pulmonary fibrosis HP:0004322 | Short stature HP:0001522 | Death in infancy HP:0010729 | Cherry red spot of the macula HP:0000790 | Hematuria HP:0004374 | Hemiplegia/hemiparesis HP:0004380 | Aortic valve calcification HP:0002804 | Arthrogryposis multiplex congenita HP:0001903 | Anemia HP:0008872 | Feeding difficulties in infancy HP:0000924 | Abnormality of the skeletal system HP:0001876 | Pancytopenia HP:0002071 | Abnormality of extrapyramidal motor function HP:0002754 | Osteomyelitis HP:0007957 | Corneal opacity HP:0002093 | Respiratory insufficiency HP:0011001 | Increased bone mineral density HP:0000225 | Gingival bleeding HP:0002757 | Recurrent fractures HP:0000938 | Osteopenia HP:0100022 | Abnormality of movement HP:0002758 | Osteoarthritis HP:0001945 | Fever HP:0000823 | Delayed puberty HP:0002240 | Hepatomegaly HP:0002069 | Generalized tonic-clonic seizures HP:0001892 | Abnormal bleeding HP:0001744 | Splenomegaly HP:0001394 | Cirrhosis HP:0000488 | Retinopathy HP:0001337 | Tremor HP:0001387 | Joint stiffness HP:0002750 | Delayed skeletal maturation HP:0006530 | Interstitial pulmonary disease HP:0000716 | Depression HP:0010885 | Aseptic necrosis HP:0006824 | Cranial nerve paralysis HP:0011227 | Elevated C-reactive protein level HP:0012115 | Hepatitis HP:0001252 | Muscular hypotonia HP:0002092 | Pulmonary arterial hypertension HP:0002123 | Generalized myoclonic seizures HP:0000238 | Hydrocephalus HP:0010702 | Increased antibody level in blood HP:0008064 | Ichthyosis HP:0004382 | Mitral valve calcification |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:43) HP:0001873 | Low platelet count | 4 HP:0001744 | Splenomegaly | 4 HP:0001336 | Myoclonic jerks | 2 HP:0010885 | Aseptic necrosis | 2 HP:0001909 | Leukemia | 2 HP:0001396 | Cholestasis | 2 HP:0001433 | Enlarged liver and spleen | 2 HP:0001409 | Portal hypertension | 2 HP:0001903 | Anemia | 2 HP:0000822 | Hypertension | 2 HP:0100543 | Cognitive deficits | 1 HP:0008064 | Ichthyosis | 1 HP:0000938 | Decreased bone mineral density | 1 HP:0001271 | Polyneuropathy | 1 HP:0000657 | Oculomotor apraxia | 1 HP:0002376 | Loss of developmental milestones | 1 HP:0000855 | Insulin resistance | 1 HP:0001399 | Liver failure | 1 HP:0003201 | Rhabdomyolysis | 1 HP:0002665 | Lymphoma | 1 HP:0200058 | Angiosarcoma | 1 HP:0002754 | Bone infection | 1 HP:0012531 | Pain | 1 HP:0100315 | Lewy bodies | 1 HP:0012191 | B-cell lymphoma | 1 HP:0100014 | Macular pucker | 1 HP:0002953 | Vertebral compression fractures | 1 HP:0002186 | Apraxia | 1 HP:0002092 | Pulmonary artery hypertension | 1 HP:0000238 | Nonsyndromal hydrocephalus | 1 HP:0001928 | Abnormal blood coagulation studies | 1 HP:0001081 | Gallstones | 1 HP:0002653 | Bone pain | 1 HP:0006775 | Multiple myeloma | 1 HP:0000708 | Behavioral problems | 1 HP:0001334 | Communicating hydrocephalus | 1 HP:0001648 | Cor pulmonale | 1 HP:0100310 | Extradural hematoma | 1 HP:0003287 | Abnormality of mitochondrial metabolism | 1 HP:0006532 | Pneumonia, recurrent episodes | 1 HP:0001300 | Parkinsonism | 1 HP:0002240 | Enlarged liver | 1 HP:0006721 | Acute lymphocytic leukemia | 1 |
| Disease ID | 3 |
|---|---|
| Disease | gaucher disease |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:45) C2700565 | pancreatic cancer C2186532 | liver disease C1963266 | uveitis C1963220 | pulmonary hypertension C1963138 | hypertension C1962958 | hematoma C1961102 | lymphoblastic leukemia C1512411 | hepatocellular carcinoma C1444690 | masquerade syndrome C1402315 | vascular lesions C1393529 | vascular complications C0752303 | urological manifestations C0685201 | angioma of the spleen C0600452 | hepatopulmonary syndrome C0520745 | splenic hemorrhage C0398623 | thrombophilia C0376545 | hematological malignancies C0376545 | hematologic malignancies C0272247 | biclonal gammopathy C0268381 | al amyloidosis C0264778 | tricuspid insufficiency C0262405 | brain dysfunction C0242422 | parkinsonism C0235325 | gastric bleeding C0235031 | neurological symptoms C0151825 | skeletal pain C0079154 | congenital ichthyosis C0040034 | thrombocytopenia C0038539 | subdural empyema C0029443 | osteomyelitis C0027726 | nephrotic syndrome C0027066 | myoclonus C0026848 | myopathy C0026764 | myeloma C0026764 | multiple myeloma C0021345 | infectious mononucleosis C0020541 | portal hypertension C0020455 | hypergammaglobulinemia C0020305 | hydrops fetalis C0014550 | myoclonic epilepsy C0008533 | factor ix deficiency C0008350 | cholelithiasis C0005940 | bone disease C0005779 | coagulopathy C0004623 | bacterial infections |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:17) C0040034 | thrombocytopenia | 4 C0005940 | bone disease | 3 C0027066 | myoclonus | 2 C0752303 | urological manifestations | 2 C0242422 | parkinsonism | 1 C0600452 | hepatopulmonary syndrome | 1 C0023895 | liver disease | 1 C0023448 | lymphoblastic leukemia | 1 C0019045 | hemoglobinopathy | 1 C0029443 | osteomyelitis | 1 C0026764 | multiple myeloma | 1 C0018944 | hematoma | 1 C0014867 | esophageal varices | 1 C0020538 | hypertension | 1 C0008350 | cholelithiasis | 1 C0020542 | pulmonary hypertension | 1 C0751778 | progressive myoclonic epilepsy | 1 |
Manually Genotype(Total Manually Genotypes:5) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| GBA | c.1226A>G in both | doi:10.1038/gim.2016.8 | Expanded carrier screening in an infertile population: how often is clinical decision making affected? |
| GBA | p.N409S, c.84dupG, p.L483P, IVS+1G>A | doi:10.1038/gim.2016.30 | Carrier screening in the era of expanding genetic technology |
| GBA | N370S | doi:10.1038/gim.2016.30 | Carrier screening in the era of expanding genetic technology |
| GBA | NM_000157.3:c.152G>T:p.S51I | doi:10.1038/gim.2016.37 | Clinical genomics can facilitate countrywide estimation of autosomal recessive disease burden |
| GBA | p.N409S | doi:10.1038/gim.2012.107 | Age-specific Parkinson disease risk in GBA mutation carriers: information for genetic counseling |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:23) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs1064644 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155238192 | A | G |
| rs1064651 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235727 | C | G |
| rs11986414 | 22388998 | 2055 | CLN8 | umls:C0017205 | GAD | [Genome-wide association study of N370S homozygous Gaucher disease reveals the candidacy of CLN8 gene as a genetic modifier contributing to extreme phenotypic variation.] | 0.002638474 | 2012 | NA | 8 | 1798784 | A | G |
| rs121908311 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235823 | C | T |
| rs121908313 | 15024629 | 2629 | GBA | umls:C0017205 | BeFree | A single nucleotide alteration in MTX1, 628T-->C, resulting in the amino acid change F202L, was identified in patients with Gaucher disease in association with the common N370S mutation in GBA. | 0.354558161 | 2004 | GBA | 1 | 155237470 | G | T |
| rs364897 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155238215 | T | C |
| rs381737 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155238141 | A | T |
| rs421016 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235252 | A | C,G |
| rs439898 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | NA | NA | NA | NA | NA |
| rs75822236 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235002 | C | T |
| rs76763715 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235843 | T | C,G |
| rs77369218 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235726 | T | A |
| rs78973108 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155237453 | C | T |
| rs79653797 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155238629 | C | T,G |
| rs79945741 | 15024629 | 2629 | GBA | umls:C0017205 | BeFree | A single nucleotide alteration in MTX1, 628T-->C, resulting in the amino acid change F202L, was identified in patients with Gaucher disease in association with the common N370S mutation in GBA. | 0.354558161 | 2004 | GBA | 1 | 155238139 | A | T |
| rs80356759 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155241085 | C | T |
| rs80356760 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155240651 | - | C |
| rs80356763 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155238596 | C | T,A |
| rs80356768 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235752 | ACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAAGG | - |
| rs80356769 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235772 | C | A |
| rs80356771 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235196 | G | T,A |
| rs80356772 | NA | 2629 | GBA | umls:C0017205 | CLINVAR | NA | 0.354558161 | NA | GBA | 1 | 155235195 | C | T |
| rs9806762 | 22388998 | 4916 | NTRK3 | umls:C0017205 | GAD | [Genome-wide association study of N370S homozygous Gaucher disease reveals the candidacy of CLN8 gene as a genetic modifier contributing to extreme phenotypic variation.] | 0.002367032 | 2012 | NTRK3 | 15 | 88118508 | A | G |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:63) | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CHR | POS | SNPID | REF | ALT | ORI_SNPID | PMID | P_VALUE | P_VALUE_TEXT | OR/BETA | CI95_TEXT | GWAS_INITIAL_SAMPLE_SIZE | SUB_POPULATION | SUPER_POPULATION | GWAS_TRAIT | HPO_ID | HPO_TERM | DO_ID | DO_TERM | MESH_ID | MESH_TERM | EFO_ID | EFO_TERM | DOLITE_TERM | RISK_ALLELE | PUBLICATION_TYPE | AA | GENE_SYMBOL | TYPE | REFGENE |
| 1 | 90626396 | rs3922967 | C | T | rs3922967 | 22388998 | 3.15E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 1 | 226973381 | rs10495250 | G | A | rs10495250 | 22388998 | 3.57E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 1582242 | rs7564265 | A | G | rs7564265 | 22388998 | 2.31E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 41976547 | rs4563280 | A | C | rs4563280 | 22388998 | 8.58E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 46311960 | rs13432276 | A | C | rs13432276 | 22388998 | 3.62E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 68100458 | rs17034538 | C | T | rs17034538 | 22388998 | 2.30E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 106674925 | rs17032247 | G | A | rs17032247 | 22388998 | 3.98E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 167218821 | rs17766561 | G | T | rs17766561 | 22388998 | 1.60E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 2 | 167224695 | rs17766807 | T | C | rs17766807 | 22388998 | 3.38E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 3 | 28652496 | rs6776912 | A | G | rs6776912 | 22388998 | 3.78E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 4 | 114118650 | rs967099 | A | G | rs967099 | 22388998 | 4.19E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 4 | 168743638 | rs1838509 | T | C | rs1838509 | 22388998 | 1.43E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 4 | 174455297 | rs2332691 | C | T | rs2332691 | 22388998 | 3.27E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 5 | 20507115 | rs906629 | C | A | rs906629 | 22388998 | 4.14E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 5 | 161517059 | rs209353 | C | T | rs209353 | 22388998 | 3.55E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 13293110 | rs543645 | C | T | rs543645 | 22388998 | 9.53E-07 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 13308083 | rs2439538 | T | C | rs2439538 | 22388998 | 2.03E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148190213 | rs11155528 | A | G | rs11155528 | 22388998 | 7.19E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148193929 | rs13198106 | C | T | rs13198106 | 22388998 | 1.74E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148200924 | rs11759320 | C | A | rs11759320 | 22388998 | 2.60E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148202273 | rs614002 | G | A | rs614002 | 22388998 | 2.91E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148221015 | rs600222 | G | T | rs600222 | 22388998 | 3.34E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148252713 | rs529563 | G | A | rs529563 | 22388998 | 2.74E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148255794 | rs510933 | T | C | rs510933 | 22388998 | 9.47E-07 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 148271373 | rs9403895 | T | C | rs9403895 | 22388998 | 8.64E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 6 | 163250778 | rs949902 | C | A | rs949902 | 22388998 | 4.29E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 7 | 47444053 | rs12702337 | C | T | rs12702337 | 22388998 | 2.41E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 7 | 109152563 | rs10231280 | C | T | rs10231280 | 22388998 | 3.20E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 606356 | rs13252487 | C | A | rs13252487 | 22388998 | 3.23E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1697086 | rs7845723 | T | G | rs7845723 | 22388998 | 9.19E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1700398 | rs7005592 | T | C | rs7005592 | 22388998 | 6.79E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1701432 | rs10105317 | G | A | rs10105317 | 22388998 | 6.00E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1703569 | rs4595147 | G | T | rs4595147 | 22388998 | 1.11E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1717036 | rs11136424 | G | A | rs11136424 | 22388998 | 1.59E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1721090 | rs4875958 | G | A | rs4875958 | 22388998 | 2.69E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1746950 | rs11986414 | A | G | rs11986414 | 22388998 | 1.00E-06 | Gaucher disease 1 severity | 3.72 | [2.19-6.31] | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | rs11986414-A | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 8 | 1748166 | rs4875960 | A | G | rs4875960 | 22388998 | 1.75E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 9 | 113791920 | rs4978977 | A | C | rs4978977 | 22388998 | 2.17E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 8329986 | rs10795615 | T | C | rs10795615 | 22388998 | 2.59E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 29628094 | rs789920 | C | T | rs789920 | 22388998 | 7.87E-07 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 43549708 | rs7088902 | T | C | rs7088902 | 22388998 | 2.74E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 80530708 | rs637446 | T | C | rs637446 | 22388998 | 3.23E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 115756130 | rs82625 | T | C | rs82625 | 22388998 | 2.00E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 127719213 | rs11244777 | A | G | rs11244777 | 22388998 | 2.96E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 10 | 127722422 | rs7920091 | A | G | rs7920091 | 22388998 | 1.11E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 12 | 6468303 | rs6489711 | T | C | rs6489711 | 22388998 | 3.84E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 12 | 47420131 | rs17097496 | C | T | rs17097496 | 22388998 | 3.11E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 12 | 127084637 | rs6489102 | C | T | rs6489102 | 22388998 | 3.22E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 15 | 88661739 | rs9806762 | A | G | rs9806762 | 22388998 | 7.00E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 15 | 88670758 | rs16941321 | T | G | rs16941321 | 22388998 | 2.22E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 15 | 92091172 | rs4932552 | C | T | rs4932552 | 22388998 | 1.84E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 16 | 2088312 | rs11876 | C | T | rs11876 | 22388998 | 4.25E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 16 | 7310508 | rs1010884 | C | T | rs1010884 | 22388998 | 2.74E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 18 | 8331825 | rs624640 | C | T | rs624640 | 22388998 | 1.79E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 18 | 45914752 | rs4940366 | G | T | rs4940366 | 22388998 | 3.85E-06 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 19 | 48330007 | rs6509345 | G | T | rs6509345 | 22388998 | 3.76E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 20 | 894951 | rs11087800 | G | A | rs11087800 | 22388998 | 1.45E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 20 | 32788141 | rs6088423 | T | G | rs6088423 | 22388998 | 3.42E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 20 | 38884188 | rs6129532 | G | T | rs6129532 | 22388998 | 1.39E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 20 | 38893386 | rs6124225 | A | G | rs6124225 | 22388998 | 2.12E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 22 | 18339012 | rs873387 | A | G | rs873387 | 22388998 | 1.94E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 22 | 18347127 | rs4819639 | C | T | rs4819639 | 22388998 | 3.70E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
| 22 | 25500496 | rs5760855 | G | T | rs5760855 | 22388998 | 3.99E-05 | NA | NA | NA | 139 Ashkenazi Jewish cases | Ashkenazi Jewish(139) | ALL(139) | MEA(139) | ALL(139) | Gaucher disease severity | HPOID:0004311 | Abnormality of macrophages | DOID:1926 | Gaucher's disease | D005776 | Gaucher Disease | NA | NA | Histiocytosis | Lipoidosis | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't |
Mapped by lexical matching(Total Items:26) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0008872 | Feeding difficulties in infancy | MP:0011075 | abnormal macrophage activation involved in immune response | anomaly in the process in which a change in response and behavior of a macrophage results from exposure to a cytokine, chemokine, cellular ligand, or soluble factor, leading to the initiation or perpetuation of an immune response |
| HP:0001654 | Abnormality of the heart valves | MP:0008158 | increased diameter of femur | increased width of the cross-sectional distance that extends from one lateral edge of the femur, through its center and to the opposite lateral edge |
| HP:0006824 | Cranial nerve paralysis | MP:0006303 | abnormal retinal nerve fiber layer morphology | any structural anomaly of the layer of the retina formed by expansion of the fibers of the optic nerve |
| HP:0000924 | Abnormality of the skeletal system | MP:0013283 | failure of ventral body wall closure | failure of the lateral body wall folds (a combination of mesoderm and ectoderm arising on each side of the embryo) to progress ventrally and meet in the midline and/or fuse to close the ventral body wall; normally, this closure is aided by growth of the h |
| HP:0002092 | Pulmonary hypertension | MP:0005258 | ocular hypertension | abnormal elevation of the intraocular pressure |
| HP:0010885 | Aseptic necrosis | MP:0001654 | hepatic necrosis | morphological changes resulting from pathological death of liver tissue; usually due to irreversible damage |
| HP:0001892 | Abnormal bleeding | MP:0005606 | increased bleeding time | greater than the normal duration of blood flow after skin puncture; indicative of platelet and capillary function |
| HP:0002069 | Generalized tonic-clonic seizures | MP:0003997 | tonic-clonic seizures | increased number or decreased threshold for the induction of a seizure characterized by initial rigidity followed by rhythmic jerking movements |
| HP:0001387 | Joint stiffness | MP:0003098 | decreased tendon stiffness | reduced ability of tendon to maintain tensile strength and load |
| HP:0001000 | Abnormality of skin pigmentation | MP:0009536 | abnormal interstitial cell of Cajal morphology | any structural anomaly in the type of cell found in the gastrointestinal tract and serving as a pacemaker that triggers gut contraction; ICCs mediate inputs from the enteric nervous system to smooth muscle cells and are thought to be the cells from which |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0010702 | Increased antibody level in blood | MP:0012336 | decreased vitamin D level | reduced level of vitamin D, any of a group of related, fat-soluble compounds that are derived from delta-5,7 steroids and play a central role in calcium metabolism; specific forms of vitamin D include calciferol (ergocalciferol; vitamin D2) and cholecalci |
| HP:0002071 | Abnormality of extrapyramidal motor function | MP:0009403 | increased variability of skeletal muscle fiber size | greater range or dispersion within a distribution of skeletal muscle fiber size within a muscle compared to controls |
| HP:0002757 | Recurrent fractures | MP:0004675 | rib fractures | a crack or break in the bones forming the bony wall of the chest |
| HP:0011227 | Elevated C-reactive protein level | MP:0008721 | abnormal chemokine level | deviation from the normal levels of any of the class of pro-inflammatory cytokines that attract and activate leukocytes |
| HP:0001103 | Abnormality of the macula | MP:0009886 | failure of palatal shelf elevation | the palatal shelves fail to move from a vertical position in the orofacial cavity to a horizontal apposition above the developing tongue |
| HP:0002123 | Generalized myoclonic seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
| HP:0100022 | Abnormality of movement | MP:0005223 | abnormal dorsal-ventral polarity of the somites | anomalous development or formation of the pattern of somites along the axis that runs from the front (ventral) to the back (dorsal) surface of the body |
| HP:0001522 | Death in infancy | MP:0000790 | abnormal stratification in cerebral cortex | abnormal formation or pattern of the layers of the cerebral cortex |
| HP:0006530 | Interstitial pulmonary disease | MP:0002295 | abnormal pulmonary circulation | any anomaly in the circulation of blood through the lungs |
| HP:0011001 | Increased bone mineral density | MP:0013630 | increased bone trabecular spacing | increase in the amount of space between trabeculae in cancellous bone |
| HP:0002750 | Delayed skeletal maturation | MP:0003379 | absent sexual maturation | failure to initiate pubertal changes that result in achievement of full sexual capacity |
| HP:0000225 | Gingival bleeding | MP:0005606 | increased bleeding time | greater than the normal duration of blood flow after skin puncture; indicative of platelet and capillary function |
| HP:0007957 | Corneal opacity | MP:0009859 | eye opacity | changes in the eye grossly observed as a milky or cloudy appearance that may be progressive and persistent throughout life |
| HP:0002206 | Pulmonary fibrosis | MP:0009419 | skeletal muscle fibrosis | formation of fibrous tissue within skeletal muscle as a result of repair or a reactive process |
| HP:0010729 | Cherry red spot of the macula | MP:0005060 | accumulation of giant lysosomes in kidney/renal tubule cells | buildup of contents in lysosomes in cells of the kidney tubules |
Mapped by homologous gene(Total Items:66) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001876 | Pancytopenia | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0002754 | Osteomyelitis | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0001945 | Fever | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002653 | Bone pain | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002758 | Osteoarthritis | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002123 | Generalized myoclonic seizures | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0004380 | Aortic valve calcification | MP:0011108 | embryonic lethality during organogenesis, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14) |
| HP:0010702 | Increased antibody level in blood | MP:0013696 | increased granulocyte monocyte progenitor cell number | increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1 |
| HP:0001654 | Abnormality of the heart valves | MP:0013696 | increased granulocyte monocyte progenitor cell number | increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1 |
| HP:0000486 | Strabismus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001103 | Abnormality of the macula | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0002015 | Dysphagia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002119 | Ventriculomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002206 | Pulmonary fibrosis | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0001522 | Death in infancy | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002240 | Hepatomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000238 | Hydrocephalus | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0004374 | Hemiplegia/hemiparesis | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001903 | Anemia | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001744 | Splenomegaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000657 | Oculomotor apraxia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002092 | Pulmonary hypertension | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002797 | Osteolysis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002093 | Respiratory insufficiency | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0100022 | Abnormality of movement | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000093 | Proteinuria | MP:0020216 | decreased circulating complement protein level | less than normal levels of the serum proteins that act sequentially to allow for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes |
| HP:0001337 | Tremor | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001000 | Abnormality of skin pigmentation | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002804 | Arthrogryposis multiplex congenita | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0007957 | Corneal opacity | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0000938 | Osteopenia | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001892 | Abnormal bleeding | MP:0020138 | delayed bone mineralization | late onset of the process by which minerals are deposited into bone |
| HP:0001873 | Thrombocytopenia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0004382 | Mitral valve calcification | MP:0011108 | embryonic lethality during organogenesis, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14) |
| HP:0001373 | Joint dislocation | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0010729 | Cherry red spot of the macula | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0012378 | Fatigue | MP:0013659 | abnormal erythroid lineage cell morphology | any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes |
| HP:0002757 | Recurrent fractures | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0010885 | Aseptic necrosis | MP:0013501 | increased fibroblast apoptosis | increase in the timing or the number of fibroblast cells undergoing programmed cell death |
| HP:0011227 | Elevated C-reactive protein level | MP:0008721 | abnormal chemokine level | deviation from the normal levels of any of the class of pro-inflammatory cytokines that attract and activate leukocytes |
| HP:0000790 | Hematuria | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002069 | Generalized tonic-clonic seizures | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0001789 | Hydrops fetalis | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0002829 | Arthralgia | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0002027 | Abdominal pain | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0001697 | Abnormality of the pericardium | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0002376 | Developmental regression | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0000365 | Hearing impairment | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0011001 | Increased bone mineral density | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000823 | Delayed puberty | MP:0020087 | increased susceptibility to non-insulin-dependent diabetes | increased likelihood to develop non-insulin-dependent diabetes |
| HP:0006530 | Interstitial pulmonary disease | MP:0011846 | decreased kidney collecting duct number | smaller than expected number of the kidney ducts that collect urine from the distal convoluted tubules, merge and become larger as they descend from the renal cortex into the medulla, and respond to vasopressin and aldosterone to regulate water, electroly |
| HP:0001251 | Ataxia | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0008872 | Feeding difficulties in infancy | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0000924 | Abnormality of the skeletal system | MP:0014071 | increased cardiac muscle glycogen level | greater than the normal concentration of a readily converted carbohydrate reserve in heart muscle |
| HP:0002071 | Abnormality of extrapyramidal motor function | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000488 | Retinopathy | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001394 | Cirrhosis | MP:0020134 | abnormal gallbladder size | an anomaly in the size of the gall bladder compared to average, the organ that serves as a storage reservoir for bile |
| HP:0008064 | Ichthyosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001387 | Joint stiffness | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000716 | Depression | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002750 | Delayed skeletal maturation | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0000225 | Gingival bleeding | MP:0020186 | altered susceptibility to bacterial infection | a change in the likelihood that an organism will develop ill effects from a bacterial infection or from components of or toxins produced by bacteria |
| HP:0012115 | Hepatitis | MP:0013716 | hypolactation | partial failure, or reduced ability to produce or secrete milk from the mammary gland |
| HP:0006824 | Cranial nerve paralysis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| Disease ID | 3 |
|---|---|
| Disease | gaucher disease |
| Case | (Waiting for update.) |